Top » Catalog » SNPs » YP258

$18.00

YP258
[YP258]

YP258
hg38 Position: ChrY:16649945..16649945
Ancestral: T
Derived: A
Reference: R1a community
ISOGG Haplogroup: R1a1a1b1a1a
Comments: .
Forward Primer: YP258_F ATTTTAATGGGAATTCTGTTTAATAGG
Reverse Primer: YP258_R AATAGGAAATTCTCAATGCTTATCTATATG
Reviews

Customers who bought this product also purchased
BY207879
BY207879
YP5253
YP5253
YP5248
YP5248
YP6476
YP6476
Y37285
Y37285
YP5950
YP5950
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies