Top » Catalog » SNPs » YP258

$18.00

YP258
[YP258]

YP258
hg38 Position: ChrY:16649945..16649945
Ancestral: T
Derived: A
Reference: R1a community
ISOGG Haplogroup: R1a1a1b1a1a
Comments: .
Forward Primer: YP258_F ATTTTAATGGGAATTCTGTTTAATAGG
Reverse Primer: YP258_R AATAGGAAATTCTCAATGCTTATCTATATG
Reviews

Customers who bought this product also purchased
YP1341
YP1341
BY30698
BY30698
Y107244
Y107244
YP1337
YP1337
Y132956
Y132956
Y166625
Y166625
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies