Top » Catalog » SNPs » YP258

$18.00

YP258
[YP258]

YP258
hg38 Position: ChrY:16649945..16649945
Ancestral: T
Derived: A
Reference: R1a community
ISOGG Haplogroup: R1a1a1b1a1a
Comments: .
Forward Primer: YP258_F ATTTTAATGGGAATTCTGTTTAATAGG
Reverse Primer: YP258_R AATAGGAAATTCTCAATGCTTATCTATATG
Reviews

Customers who bought this product also purchased
YP590
YP590
FT186708
FT186708
Z91
Z91
Y17491
Y17491
Y184194
Y184194
L145
L145
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies