Top » Catalog » SNPs » YP263

$18.00

YP263
[YP263]

YP263
hg38 Position: ChrY:19385165..19385165
Ancestral: G
Derived: T
Reference: R1a community
ISOGG Haplogroup: R1a1a1b1a1b1a
Comments: .
Forward Primer: YP263_F TCCCCACAATAGTTGCTTGTC
Reverse Primer: YP263_R TGACTGGGAGTACCGGAAAG
Reviews

Customers who bought this product also purchased
A14777
A14777
A14776
A14776
YP6047
YP6047
Y18348
Y18348
FGC66342
FGC66342
Y2395
Y2395
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies