Top » Catalog » SNPs » YP610

$18.00

YP610
[YP610]

YP610
hg38 Position: ChrY:7515184..7515184
Ancestral: T
Derived: G
Reference: R1a community
ISOGG Haplogroup: R1a (not listed)
Comments: .
Forward Primer: YP610_F ATCATACTTATCCTAAATTGTGTTCCG
Reverse Primer: YP610_R GGGTTCAAACCAAAAACCATG
Reviews

Customers who bought this product also purchased
FT58750
FT58750
BY137355
BY137355
YP590
YP590
BY29798
BY29798
YP258
YP258
BY142582
BY142582
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies