Top » Catalog » SNPs » YP592

$18.00

YP592
[YP592]

YP592
hg38 Position: ChrY:18675341..18675341
Ancestral: A
Derived: G
Reference: R1a community
ISOGG Haplogroup: R1a (not listed)
Comments: .
Forward Primer: YP592_F ATCCCAATCGTAAGCTGCTG
Reverse Primer: YP592_R GAGGTAGCTCCCTTCCACTG
Reviews

Customers who bought this product also purchased
BY30779
BY30779
BY179631
BY179631
FT168438
FT168438
FGC64564
FGC64564
YSEQ-Alpha
YSEQ-Alpha
Y129780
Y129780
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies