Top » Catalog » SNPs » YP592

$18.00

YP592
[YP592]

YP592
hg38 Position: ChrY:18675341..18675341
Ancestral: A
Derived: G
Reference: R1a community
ISOGG Haplogroup: R1a (not listed)
Comments: .
Forward Primer: YP592_F ATCCCAATCGTAAGCTGCTG
Reverse Primer: YP592_R GAGGTAGCTCCCTTCCACTG
Reviews

Customers who bought this product also purchased
Y18348
Y18348
YP6047
YP6047
YP1137
YP1137
YP728
YP728
Y37930
Y37930
Y74045
Y74045
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies