Top » Catalog » SNPs » L1280

$18.00

L1280
[L1280]

L1280
hg38 Position: ChrY:16293725..16293725
Ancestral: A
Derived: G
Reference: Thomas Krahn (FTDNA)
ISOGG Haplogroup: R1a1a1b1a2b3c
Comments: Found in a R-Z280 WTY participant
Forward Primer: L1280_F AATTCCCCAGACATGCAAAG
Reverse Primer: L1280_R CAAGGAAAATGCAGCTACCAC
Reviews

Customers who bought this product also purchased
FGC41213
FGC41213
YP6344
YP6344
YP3990
YP3990
BY3303
BY3303
YP4706
YP4706
BY3502
BY3502
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies