Top » Catalog » SNPs » S18681

$18.00

S18681
[S18681]

S18681
hg38 Position: ChrY:14587828..14587828
Ancestral: C
Derived: T
Reference: Jim Wilson (2014)
ISOGG Haplogroup: R1a1a1b1a2b3
Comments: Downstream Y33 > CTS8816
Forward Primer: S18681_F GAATGCCCTCACACCTAACC
Reverse Primer: S18681_R CCTGCTCCTTCTGTGAAATG
Reviews

Customers who bought this product also purchased
Z94
Z94
Z2124
Z2124
R1a-Z93 Panel
R1a-Z93 Panel
Z2902
Z2902
L657
L657
YP4336
YP4336
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies