Top » Catalog » SNPs » Y4459

$18.00

Y4459
[Y4459]

Y4459
hg38 Position: ChrY:19169769..19169769
Ancestral: C
Derived: T
Reference: Yfull (2014)
ISOGG Haplogroup: R1a1a1b1a2a
Comments: Downstream Z92
Forward Primer: Y4459_F GAGGTCCCCACAAGATATGG
Reverse Primer: Y4459_R AGGCTCAGCATAGCCAAAAG
Reviews

Customers who bought this product also purchased
YP1697
YP1697
YP6187
YP6187
YP1696
YP1696
BY182582
BY182582
Y58868
Y58868
Y93168
Y93168
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies