Top » Catalog » SNPs » Z685

$18.00

Z685
[Z685]

Z685
hg38 Position: ChrY:19359795..19359795
Ancestral: G
Derived: A
Reference: Ray Banks (2015)
ISOGG Haplogroup: R (not listed)
Comments: approx. with Z92.Z660.Z661
Forward Primer: Z685_F CTTCAGCCATTGTGAAGAGC
Reverse Primer: Z685_R TTCTCAACCCACAAGGATGG
Reviews

Customers who bought this product also purchased
FGC72821
FGC72821
M458
M458
Z91
Z91
YP683
YP683
Z93
Z93
Y11268
Y11268
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies