Top » Catalog » SNPs » Z91

$18.00

Z91
[Z91]

Z91
hg38 Position: ChrY:14362913..14362913
Ancestral: G
Derived: A
Reference: http://dna-forums.org/
ISOGG Haplogroup: R1a1a1b1a2
Comments: Proposed phylogeny by GregRM see http://www.box.net/shared/zc1odylvvj
Forward Primer: Z91v2_F CCTAAGGTCAGGAGTTCACAACAC
Reverse Primer: Z91v2_R TCTTGTCCAGGTGTGTGCC
Reviews

Customers who bought this product also purchased
YP4336
YP4336
YP6012
YP6012
Z2125
Z2125
YP524
YP524
Y176455
Y176455
Y15121
Y15121
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies