Top » Catalog » SNPs » Z92

$18.00

Z92
[Z92]

Z92
hg38 Position: ChrY:15473121..15473121
Ancestral: C
Derived: G
Reference: http://dna-forums.org/
ISOGG Haplogroup: R1a1a1b1a2a
Comments: Proposed phylogeny by GregRM see http://www.box.net/shared/zc1odylvvj
Forward Primer: Z92_F CATTCTCAGCAGGGAAGGAC
Reverse Primer: Z92_R TAGGCCTCAAGAATGAGCAG
Reviews

Customers who bought this product also purchased
YP1696
YP1696
BY182582
BY182582
Y58868
Y58868
YP1697
YP1697
YP6187
YP6187
YP6214
YP6214
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies