Top » Catalog » SNPs » Z92

$18.00

Z92
[Z92]

Z92
HG19 Position: ChrY:15473121..15473121
Ancestral: C
Derived: G
Reference: http://dna-forums.org/
ISOGG Haplogroup: R1a1a1b1a2a
Comments: Proposed phylogeny by GregRM see http://www.box.net/shared/zc1odylvvj
Forward Primer: Z92_F CATTCTCAGCAGGGAAGGAC
Reverse Primer: Z92_R TAGGCCTCAAGAATGAGCAG
Reviews

Customers who bought this product also purchased
L664
L664
Y2395
Y2395
M458
M458
Z93
Z93
Z282
Z282
YP968
YP968
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies