Top » Catalog » SNPs » Z92

$18.00

Z92
[Z92]

Z92
HG19 Position: ChrY:17585001..17585001
Ancestral: C
Derived: G
Reference: http://dna-forums.org/
ISOGG Haplogroup: R1a1a1b1a2a
Comments: Proposed phylogeny by GregRM see http://www.box.net/shared/zc1odylvvj
Forward Primer: Z92_F CATTCTCAGCAGGGAAGGAC
Reverse Primer: Z92_R TAGGCCTCAAGAATGAGCAG
Reviews

Customers who bought this product also purchased
HVR1
HVR1
DNA Sample Kit
DNA Sample Kit
YP4288
YP4288
Y13467
Y13467
BY357
BY357
BY3301
BY3301
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies