Top » Catalog » SNPs » Z92

$18.00

Z92
[Z92]

Z92
hg38 Position: ChrY:15473121..15473121
Ancestral: C
Derived: G
Reference: http://dna-forums.org/
ISOGG Haplogroup: R1a1a1b1a2a
Comments: Proposed phylogeny by GregRM see http://www.box.net/shared/zc1odylvvj
Forward Primer: Z92_F CATTCTCAGCAGGGAAGGAC
Reverse Primer: Z92_R TAGGCCTCAAGAATGAGCAG
Reviews

Customers who bought this product also purchased
Y24032
Y24032
YP350
YP350
YP1363
YP1363
YP325
YP325
Y4376
Y4376
YP5509
YP5509
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies