Top » Catalog » SNPs » Z2188

$18.00

Z2188
[Z2188]

Z2188
hg38 Position: ChrY:8609519..8609519
Ancestral: C
Derived: G
Reference: Greg Magoon 2012
ISOGG Haplogroup: R1b1a1a2a1a2c1f2d1a~
Comments: downstream of Z253; parallel to L1066
Forward Primer: Z2188_F CATTGGTCTGTTGCTGGATG
Reverse Primer: Z2188_R AGCTGAGACCCCAGAGTCAG
Reviews

Customers who bought this product also purchased
FGC3249
FGC3249
R1b-L21 Superclade Orientation Panel
R1b-L21 Superclade Orientation Panel
Z29749
Z29749
DF21
DF21
A17
A17
DF73
DF73
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies