Top » Catalog » SNPs » Z2188

$18.00

Z2188
[Z2188]

Z2188
hg38 Position: ChrY:8609519..8609519
Ancestral: C
Derived: G
Reference: Greg Magoon 2012
ISOGG Haplogroup: R1b1a1a2a1a2c1f2d1a~
Comments: downstream of Z253; parallel to L1066
Forward Primer: Z2188_F CATTGGTCTGTTGCTGGATG
Reverse Primer: Z2188_R AGCTGAGACCCCAGAGTCAG
Reviews

Customers who bought this product also purchased
Z253
Z253
Z2185
Z2185
S928
S928
Z39589
Z39589
L226
L226
A1002
A1002
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies