Top » Catalog » SNPs » FGC14507

$18.00

FGC14507
[FGC14507]

FGC14507
hg38 Position: ChrY:16093684..16093684
Ancestral: G
Derived: A
Reference: Full Genomes Corp. (2014)
ISOGG Haplogroup: I1 (not listed)
Comments: .
Forward Primer: FGC14507_F GAGATCACTTGAGCCCAAGAATAC
Reverse Primer: FGC14507_R TCTTGCAAGGATGCATCTTTAAC
Reviews

Customers who bought this product also purchased
I1 VA-A THORNTON Family Panel v5
I1 VA-A THORNTON Family Panel v5
FGC35955
FGC35955
FGC22112
FGC22112
Y33772
Y33772
A7626
A7626
FGC43220
FGC43220
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies