Top » Catalog » SNPs » FGC22110

$18.00

FGC22110
[FGC22110]

FGC22110
hg38 Position: ChrY:19067922..19067922
Ancestral: T
Derived: C
Reference: Full Genomes Corp (2014)
ISOGG Haplogroup: I1 (not listed)
Comments: .
Forward Primer: FGC22110_F AATACCAGTCTGTCTTAGACAATAGAGCT
Reverse Primer: FGC22110_R CAGTGGAGGGAATTGGGA
Reviews

Customers who bought this product also purchased
A7628
A7628
S7660
S7660
FGC35957
FGC35957
FGC17110
FGC17110
A7627
A7627
I1 VA-A THORNTON Family Panel v5
I1 VA-A THORNTON Family Panel v5
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies