Top » Catalog » SNPs » FGC22110

$18.00

FGC22110
[FGC22110]

FGC22110
hg38 Position: ChrY:19067922..19067922
Ancestral: T
Derived: C
Reference: Full Genomes Corp (2014)
ISOGG Haplogroup: I1 (not listed)
Comments: .
Forward Primer: FGC22110_F AATACCAGTCTGTCTTAGACAATAGAGCT
Reverse Primer: FGC22110_R CAGTGGAGGGAATTGGGA
Reviews

Customers who bought this product also purchased
FGC22115
FGC22115
FGC23559
FGC23559
FGC35959
FGC35959
FGC23548
FGC23548
FGC22113
FGC22113
FGC14508
FGC14508
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies