Top » Catalog » SNPs » YP1034

$18.00

YP1034
[YP1034]

YP1034
hg38 Position: ChrY:8491450..8491450
Ancestral: A
Derived: G
Reference: R1a community
ISOGG Haplogroup: R1a (not listed)
Comments: .
Forward Primer: YP1034_F CTGTATACGGTTGTCAAGATGATACG
Reverse Primer: YP1034_R AAGATACATGTGTAAGAGCCCCAG
Reviews

Customers who bought this product also purchased
YP613
YP613
YP4286
YP4286
YP235
YP235
HVR1
HVR1
YP6098
YP6098
YP3929
YP3929
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies