Top » Catalog » SNPs » YP1034

$18.00

YP1034
[YP1034]

YP1034
hg38 Position: ChrY:8491450..8491450
Ancestral: A
Derived: G
Reference: R1a community
ISOGG Haplogroup: R1a (not listed)
Comments: .
Forward Primer: YP1034_F CTGTATACGGTTGTCAAGATGATACG
Reverse Primer: YP1034_R AAGATACATGTGTAAGAGCCCCAG
Reviews

Customers who bought this product also purchased
S3359
S3359
YP1032
YP1032
M458
M458
M417
M417
Y10811
Y10811
R1a Superclade Panel
R1a Superclade Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies