Top » Catalog » SNPs » S1686

$18.00

S1686
[S1686]

S1686
hg38 Position: ChrY:15150353..15150353
Ancestral: G
Derived: A
Reference: Jim Wilson (2014)
ISOGG Haplogroup: R1b (not listed)
Comments: Below U198
Forward Primer: S1686_F GGTGCTGGGAAAACTGTCA
Reverse Primer: S1686_R TTTTCATGTGTTTTTTTGGCC
Reviews

Customers who bought this product also purchased
L151
L151
M269
M269
Z2103
Z2103
BY39605
BY39605
S9891
S9891
A14230
A14230
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies