Top » Catalog » SNPs » Y4376

$18.00

Y4376
[Y4376]

Y4376
hg38 Position: ChrY:19058647..19058647
Ancestral: C
Derived: T
Reference: Yfull (2014)
ISOGG Haplogroup: R1a (not listed)
Comments: Probably phylo-equivalent to YP331
Forward Primer: Y4376_F GAGTAGCTAGGATTACAGGCATGTG
Reverse Primer: Y4376_R GTCTTTACACAATCCTGCGTGT
Reviews

Customers who bought this product also purchased
M458
M458
*TOP* - Top-Level Orientation Panel
*TOP* - Top-Level Orientation Panel
Z283
Z283
L145
L145
M343
M343
BY79500
BY79500
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies