Top » Catalog » SNPs » Y33

$18.00

Y33
[Y33]

Y33
hg38 Position: ChrY:8791515..8791515
Ancestral: G
Derived: A
Reference: YFull Project
ISOGG Haplogroup: R1a not listed
Comments: Near R1a; R-Z280; R-CTS3402
Forward Primer: Y33_F CTTGCTAACATAGTCTAATGAGGTCC
Reverse Primer: Y33_R GCATATCTGTCTGGCAGATCTC
Reviews

Customers who bought this product also purchased
FGC4501
FGC4501
ZS12661
ZS12661
YP1410
YP1410
Y17619
Y17619
YP953
YP953
Y35868
Y35868
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies