Top » Catalog » SNPs » Y33

$18.00

Y33
[Y33]

Y33
hg38 Position: ChrY:8791515..8791515
Ancestral: G
Derived: A
Reference: YFull Project
ISOGG Haplogroup: R1a not listed
Comments: Near R1a; R-Z280; R-CTS3402
Forward Primer: Y33_F CTTGCTAACATAGTCTAATGAGGTCC
Reverse Primer: Y33_R GCATATCTGTCTGGCAGATCTC
Reviews

Customers who bought this product also purchased
YP350
YP350
YP351
YP351
YP4465
YP4465
Z685
Z685
Y80733
Y80733
Y201632
Y201632
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies