Top » Catalog » SNPs » Y33

$18.00

Y33
[Y33]

Y33
hg38 Position: ChrY:8791515..8791515
Ancestral: G
Derived: A
Reference: YFull Project
ISOGG Haplogroup: R1a not listed
Comments: Near R1a; R-Z280; R-CTS3402
Forward Primer: Y33_F CTTGCTAACATAGTCTAATGAGGTCC
Reverse Primer: Y33_R GCATATCTGTCTGGCAGATCTC
Reviews

Customers who bought this product also purchased
R1a-Z93 Panel
R1a-Z93 Panel
Y48979
Y48979
YP4090
YP4090
YP4094
YP4094
YP565
YP565
S24902
S24902
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies