Top » Catalog » SNPs » Y33

$18.00

Y33
[Y33]

Y33
hg38 Position: ChrY:8791515..8791515
Ancestral: G
Derived: A
Reference: YFull Project
ISOGG Haplogroup: R1a not listed
Comments: Near R1a; R-Z280; R-CTS3402
Forward Primer: Y33_F CTTGCTAACATAGTCTAATGAGGTCC
Reverse Primer: Y33_R GCATATCTGTCTGGCAGATCTC
Reviews

Customers who bought this product also purchased
YP6012
YP6012
A25193
A25193
Y23849
Y23849
YP4659
YP4659
YP3929
YP3929
YP613
YP613
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies