Top » Catalog » SNPs » Y51459

$15.00

Y51459
[Y51459]

Y51459
hg38 Position: ChrY:13977487..13977487
Ancestral: G
Derived: T
Reference: YFull (2015)
ISOGG Haplogroup: N
Comments: .
Forward Primer: Y51459_F TTTGGCAAAGCTGTGGAAC
Reverse Primer: Y51459_R TTTAATTGACATAGTGCTATCATTTGG
Reviews

Customers who bought this product also purchased
Y55351
Y55351
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies