Top » Catalog » SNPs » FGC11555

$18.00

FGC11555
[FGC11555]

FGC11555
hg38 Position: ChrY:20049035..20049035
Ancestral: A
Derived: C
Reference: Full Genomes (2014)
ISOGG Haplogroup: R1a1a1b1a2b3c1
Comments: Downstream L1280
Forward Primer: FGC11555_F AATGACCAGATCTACAGTTGACAGG
Reverse Primer: FGC11555_R CTTCACTTTTGAAGTTTAGTTTGGCTAC
Reviews

Customers who bought this product also purchased
R1a Superclade Panel
R1a Superclade Panel
Y5647
Y5647
Y2395
Y2395
YP237
YP237
FGC19283
FGC19283
Z91
Z91
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies