Top » Catalog » SNPs » FGC11555

$18.00

FGC11555
[FGC11555]

FGC11555
hg38 Position: ChrY:20049035..20049035
Ancestral: A
Derived: C
Reference: Full Genomes (2014)
ISOGG Haplogroup: R1a1a1b1a2b3c1
Comments: Downstream L1280
Forward Primer: FGC11555_F AATGACCAGATCTACAGTTGACAGG
Reverse Primer: FGC11555_R CTTCACTTTTGAAGTTTAGTTTGGCTAC
Reviews

Customers who bought this product also purchased
FGC19283
FGC19283
Z91
Z91
BY334
BY334
YP968
YP968
M458
M458
CTS1211
CTS1211
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies