Top » Catalog » SNPs » YP1080

$18.00

YP1080
[YP1080]

YP1080
hg38 Position: ChrY:13062196..13062196
Ancestral: C
Derived: T
Reference: R1a community
ISOGG Haplogroup: R1a (not listed)
Comments: .
Forward Primer: YP1080_F TGTCTTTTCCAGCAAGCAAC
Reverse Primer: YP1080_R TGCTCCTTCCTTACTGATTTCC
Reviews

Customers who bought this product also purchased
A7018
A7018
A7023
A7023
A7017
A7017
A7022
A7022
A7015
A7015
A7021
A7021
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies