Top » Catalog » SNPs » YP1080

$18.00

YP1080
[YP1080]

YP1080
hg38 Position: ChrY:13062196..13062196
Ancestral: C
Derived: T
Reference: R1a community
ISOGG Haplogroup: R1a (not listed)
Comments: .
Forward Primer: YP1080_F TGTCTTTTCCAGCAAGCAAC
Reverse Primer: YP1080_R TGCTCCTTCCTTACTGATTTCC
Reviews

Customers who bought this product also purchased
A7023
A7023
A7017
A7017
A7022
A7022
A7015
A7015
A7021
A7021
R1a-YP1078 Segregation Panel
R1a-YP1078 Segregation Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies