Top » Catalog » SNPs » YP1080

$18.00

YP1080
[YP1080]

YP1080
hg38 Position: ChrY:13062196..13062196
Ancestral: C
Derived: T
Reference: R1a community
ISOGG Haplogroup: R1a (not listed)
Comments: .
Forward Primer: YP1080_F TGTCTTTTCCAGCAAGCAAC
Reverse Primer: YP1080_R TGCTCCTTCCTTACTGATTTCC
Reviews

Customers who bought this product also purchased
Y30194
Y30194
YP237
YP237
Y10802
Y10802
Y33
Y33
YP6001
YP6001
Z91
Z91
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies