Top » Catalog » SNPs » L1034

$18.00

L1034
[L1034]

L1034
hg38 Position: ChrY:19484512..19484512
Ancestral: G
Derived: C
Reference: Thomas Krahn (FTDNA)
ISOGG Haplogroup: N1a1a1a1a2a1c1~
Comments: Below Z1936
Forward Primer: L1034_F GATGTGGGGACTGAAATAGCA
Reverse Primer: L1034_R TCATGAGGTTACCATGAACACTG
Reviews

Customers who bought this product also purchased
Y13850
Y13850
Z1936
Z1936
Z1930
Z1930
CTS6904
CTS6904
Z1934
Z1934
CTS9976
CTS9976
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies