Top » Catalog » SNPs » L1034

$18.00

L1034
[L1034]

L1034
hg38 Position: ChrY:19484512..19484512
Ancestral: G
Derived: C
Reference: Thomas Krahn (FTDNA)
ISOGG Haplogroup: N1a1a1a1a2a1c1~
Comments: Below Z1936
Forward Primer: L1034_F GATGTGGGGACTGAAATAGCA
Reverse Primer: L1034_R TCATGAGGTTACCATGAACACTG
Reviews

Customers who bought this product also purchased
CTS6904
CTS6904
Z1934
Z1934
CTS9976
CTS9976
CTS4329
CTS4329
L1032
L1032
L550
L550
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies