Top » Catalog » SNPs » L1034

$18.00

L1034
[L1034]

L1034
hg38 Position: ChrY:19484512..19484512
Ancestral: G
Derived: C
Reference: Thomas Krahn (FTDNA)
ISOGG Haplogroup: N1a1a1a1a2a1c1~
Comments: Below Z1936
Forward Primer: L1034_F GATGTGGGGACTGAAATAGCA
Reverse Primer: L1034_R TCATGAGGTTACCATGAACACTG
Reviews

Customers who bought this product also purchased
CTS4125
CTS4125
Y19454
Y19454
YP6094
YP6094
N Superclade Panel
N Superclade Panel
YP5256
YP5256
VL62
VL62
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies