Top » Catalog » SNPs » YP1341

$18.00

YP1341
[YP1341]

YP1341
hg38 Position: ChrY:17058162..17058162
Ancestral: T
Derived: A
Reference: Yfull (2015)
ISOGG Haplogroup: R1a (not listed)
Comments: Downstream L260
Forward Primer: YP1341_F ATTCCCTTCCACAAAACTGG
Reverse Primer: YP1341_R TGCATTGTATCACTGCCTTTG
Reviews

Customers who bought this product also purchased
Z4624
Z4624
YP258
YP258
Y37285
Y37285
DYS518
DYS518
DYS385
DYS385
Y166625
Y166625
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies