Top » Catalog » SNPs » YP1341

$18.00

YP1341
[YP1341]

YP1341
hg38 Position: ChrY:17058162..17058162
Ancestral: T
Derived: A
Reference: Yfull (2015)
ISOGG Haplogroup: R1a (not listed)
Comments: Downstream L260
Forward Primer: YP1341_F ATTCCCTTCCACAAAACTGG
Reverse Primer: YP1341_R TGCATTGTATCACTGCCTTTG
Reviews

Customers who bought this product also purchased
R1a-M458 Panel
R1a-M458 Panel
Y4135
Y4135
M458
M458
YP414
YP414
Z93
Z93
Y2905
Y2905
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies