Top » Catalog » SNPs » YP1341

$18.00

YP1341
[YP1341]

YP1341
hg38 Position: ChrY:17058162..17058162
Ancestral: T
Derived: A
Reference: Yfull (2015)
ISOGG Haplogroup: R1a (not listed)
Comments: Downstream L260
Forward Primer: YP1341_F ATTCCCTTCCACAAAACTGG
Reverse Primer: YP1341_R TGCATTGTATCACTGCCTTTG
Reviews

Customers who bought this product also purchased
L664
L664
YP6476
YP6476
CTS1211
CTS1211
YP5250
YP5250
Z91
Z91
YP5253
YP5253
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies