Top » Catalog » SNPs » YP1341

$18.00

YP1341
[YP1341]

YP1341
hg38 Position: ChrY:17058162..17058162
Ancestral: T
Derived: A
Reference: Yfull (2015)
ISOGG Haplogroup: R1a (not listed)
Comments: Downstream L260
Forward Primer: YP1341_F ATTCCCTTCCACAAAACTGG
Reverse Primer: YP1341_R TGCATTGTATCACTGCCTTTG
Reviews

Customers who bought this product also purchased
Y140901
Y140901
Y166631
Y166631
L62
L62
FT186708
FT186708
L145
L145
Y184194
Y184194
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies