Top » Catalog » SNPs » YP619

$18.00

YP619
[YP619]

YP619
hg38 Position: ChrY:7202297..7202297
Ancestral: G
Derived: A
Reference: R1a community
ISOGG Haplogroup: R1a (not listed)
Comments: .
Forward Primer: YP619_F AGTCTAGGCACAGCCAAAGC
Reverse Primer: YP619_R TGGGTCATAGCATGTGTAGGG
Reviews

Customers who bought this product also purchased
FT160440
FT160440
L664
L664
M343
M343
CTS1211
CTS1211
*TOP* - Top-Level Orientation SNP Panel
*TOP* - Top-Level Orientation SNP Panel
L145
L145
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies