Top » Catalog » SNPs » A2329

$18.00

A2329
[A2329]

A2329
hg38 Position: ChrY:15550931..15550931
Ancestral: G
Derived: A
Reference: Zdenko Markovic (2015)
ISOGG Haplogroup: I2a1b1a
Comments: Downstream S2742
Forward Primer: A2329_F GATGAAAGATAGACATATAGATGGAACAC
Reverse Primer: A2329_R TTAAAGCACCTCTGAAAATGTCC
Reviews

Customers who bought this product also purchased
FT14506
FT14506
Y6651
Y6651
Y108172
Y108172
Y3548
Y3548
Y14612
Y14612
Y126296
Y126296
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies