Top » Catalog » SNPs » M92

$18.00

M92
[M92]

M92
hg38 Position: ChrY:19742137..19742137
Ancestral: T
Derived: C
Reference: Underhill et al. 2001
ISOGG Haplogroup: J2a1b1
Comments: B9.G2
Forward Primer: M92_F TTGAATTTCCCAGAATTTTGC
Reverse Primer: M92_R TTCAGAAACTGGTTTTGTGTCC
Reviews

Customers who bought this product also purchased
CTS3818
CTS3818
J2a-L24 Panel
J2a-L24 Panel
M172
M172
M168
M168
FT213749
FT213749
M267
M267
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies