Top » Catalog » SNPs » M92

$18.00

M92
[M92]

M92
hg38 Position: ChrY:19742137..19742137
Ancestral: T
Derived: C
Reference: Underhill et al. 2001
ISOGG Haplogroup: J2a1b1
Comments: B9.G2
Forward Primer: M92_F TTGAATTTCCCAGAATTTTGC
Reverse Primer: M92_R TTCAGAAACTGGTTTTGTGTCC
Reviews

Customers who bought this product also purchased
FGC21419
FGC21419
Y16356
Y16356
Y20492
Y20492
ZS6172
ZS6172
Z6270
Z6270
Y16996
Y16996
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies