Top » Catalog » SNPs » M92

$18.00

M92
[M92]

M92
hg38 Position: ChrY:19742137..19742137
Ancestral: T
Derived: C
Reference: Underhill et al. 2001
ISOGG Haplogroup: J2a1b1
Comments: B9.G2
Forward Primer: M92_F TTGAATTTCCCAGAATTTTGC
Reverse Primer: M92_R TTCAGAAACTGGTTTTGTGTCC
Reviews

Customers who bought this product also purchased
FGC21388
FGC21388
FGC21362
FGC21362
Y15915
Y15915
FGC21373
FGC21373
FT156609
FT156609
FGC21419
FGC21419
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies