Top » Catalog » SNPs » A2423

$18.00

A2423
[A2423]

A2423
hg38 Position: ChrY:17128713..17128713
Ancestral: C
Derived: T
Reference: Zdenko Markovic (2015)
ISOGG Haplogroup: I2a1b2a1a1 (not listed)
Comments: Below S17250 > Z16971
Forward Primer: A2423_F GTCTTGAAATACTGTGCCCTGG
Reverse Primer: A2423_R TGAAGCATGATATCCCACAATTTAC
Reviews

Customers who bought this product also purchased
Y4460
Y4460
A5875
A5875
A16681
A16681
BY183912
BY183912
Y5595
Y5595
PH908
PH908
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies