Top » Catalog » SNPs » A2501

$18.00

A2501
[A2501]

A2501
hg38 Position: ChrY:13466760..13466760
Ancestral: A
Derived: G
Reference: Iain Kennedy (2015)
ISOGG Haplogroup: R1b (not listed)
Comments: Below M222 > S658 > S660
Forward Primer: A2501_F TGGGAAGCACCCATTTTATG
Reverse Primer: A2501_R GGGCAACACTCTGTCTCAAAG
Reviews

Customers who bought this product also purchased
Y150210
Y150210
P312
P312
DF41
DF41
BY108617
BY108617
M343
M343
L1335
L1335
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies