Top » Catalog » SNPs » SK1363

$18.00

SK1363
[SK1363]

SK1363
hg38 Position: ChrY:14667731..14667731
Ancestral: G
Derived: A
Reference: Mark Stoneking and Ryan Wei (2014)
ISOGG Haplogroup: J2a1 (not listed)
Comments: Downstream L26
Forward Primer: SK1363_F TCCCTTCACAATTCAACAAAGAG
Reverse Primer: SK1363_R AGGGACCTGAATGATCTGTTG
Reviews

Customers who bought this product also purchased
M319
M319
M67
M67
L227
L227
Z6065
Z6065
FGC21373
FGC21373
mtComplete
mtComplete
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies