Top » Catalog » SNPs » SK1363

$18.00

SK1363
[SK1363]

SK1363
hg38 Position: ChrY:14667731..14667731
Ancestral: G
Derived: A
Reference: Mark Stoneking and Ryan Wei (2014)
ISOGG Haplogroup: J2a1 (not listed)
Comments: Downstream L26
Forward Primer: SK1363_F TCCCTTCACAATTCAACAAAGAG
Reverse Primer: SK1363_R AGGGACCTGAATGATCTGTTG
Reviews

Customers who bought this product also purchased
Z6065
Z6065
FGC21373
FGC21373
mtComplete
mtComplete
Z467
Z467
J2a-M67 Panel
J2a-M67 Panel
FGC3361
FGC3361
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies