Top » Catalog » SNPs » SK1363

$18.00

SK1363
[SK1363]

SK1363
hg38 Position: ChrY:14667731..14667731
Ancestral: G
Derived: A
Reference: Mark Stoneking and Ryan Wei (2014)
ISOGG Haplogroup: J2a1 (not listed)
Comments: Downstream L26
Forward Primer: SK1363_F TCCCTTCACAATTCAACAAAGAG
Reverse Primer: SK1363_R AGGGACCTGAATGATCTGTTG
Reviews

Customers who bought this product also purchased
Z36830
Z36830
FGC3361
FGC3361
M319
M319
Y15247
Y15247
Z30388
Z30388
M67
M67
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies