Top » Catalog » SNPs » Z2124

$18.00

Z2124
[Z2124]

Z2124
hg38 Position: ChrY:4653637..4653637
Ancestral: C
Derived: G
Reference: Gregory Magoon (2012)
ISOGG Haplogroup: R1a1a1b2a2
Comments: Downstream of Z93 > Z94
Forward Primer: Z2124v2_F GAAAGAGGGAATATCACAACAGG
Reverse Primer: Z2124v2_R GGAAAGGGTTCCCTCTCTTG
Reviews

Customers who bought this product also purchased
YP5850
YP5850
YP1548
YP1548
S23201
S23201
FGC48758
FGC48758
YP1457
YP1457
Y873
Y873
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies