Top » Catalog » SNPs » FGC31715

$18.00

FGC31715
[FGC31715]

FGC31715
hg38 Position: ChrY:9933665..9933665
Ancestral: A
Derived: C
Reference: Full Genomes Corp (2015)
ISOGG Haplogroup: G2a2b2a1a1c1a1b1a1a2
Comments: Below FGC249.
Forward Primer: FGC31715_F ACACATAACCACGACAGGCC
Reverse Primer: FGC31715_R GGCTGGAGTACAATGACATAATCAG
Reviews

Customers who bought this product also purchased
Z6028
Z6028
Z724
Z724
U1
U1
FGC251
FGC251
L497
L497
Z27232
Z27232
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Haplogroup Info
Other products
Currencies