Top » Catalog » SNPs » FGC31715

$18.00

FGC31715
[FGC31715]

FGC31715
hg38 Position: ChrY:9933665..9933665
Ancestral: A
Derived: C
Reference: Full Genomes Corp (2015)
ISOGG Haplogroup: G2a2b2a1a1c1a1b1a1a2
Comments: Below FGC249.
Forward Primer: FGC31715_F ACACATAACCACGACAGGCC
Reverse Primer: FGC31715_R GGCTGGAGTACAATGACATAATCAG
Reviews

Customers who bought this product also purchased
Z6032
Z6032
G2a-L1259 Panel
G2a-L1259 Panel
Z3428
Z3428
FGC31708
FGC31708
mtUpgrade
mtUpgrade
HU1
HU1
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies