Top » Catalog » SNPs » Y44043

$18.00

Y44043
[Y44043]

Y44043
hg38 Position: ChrY:20762639..20762639
Ancestral: G
Derived: A
Reference: YFull (2014)
ISOGG Haplogroup: I2
Comments: Below M223 > L1229 > Y4761
Forward Primer: Y44043_F TTGATGCAGTGTCCCTTCTG
Reverse Primer: Y44043_R CTGGCCAATATGGTGAAACC
Reviews

Customers who bought this product also purchased
I2 Superclade Panel
I2 Superclade Panel
CTS616
CTS616
Y4760
Y4760
Z2079
Z2079
Y4731
Y4731
M284
M284
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies