Top » Catalog » SNPs » ZS10640

$18.00

ZS10640
[ZS10640]

ZS10640
hg38 Position: ChrY:7679546..7679546
Ancestral: G
Derived: A
Reference: Victar Mas (2016)
ISOGG Haplogroup: J1
Comments: downstream FGC2
Forward Primer: ZS10640_F CGTCCTTCACCTGGAGCTG
Reverse Primer: ZS10640_R GGTGACTGCCTTGAAGAAGAC
Reviews

Customers who bought this product also purchased
FGC5441
FGC5441
*TOP* - Top-Level Orientation Panel
*TOP* - Top-Level Orientation Panel
ZS8321
ZS8321
FGC2
FGC2
FGC4492
FGC4492
FGC29811
FGC29811
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies