Top » Catalog » SNPs » ZS10640

$18.00

ZS10640
[ZS10640]

ZS10640
hg38 Position: ChrY:7679546..7679546
Ancestral: G
Derived: A
Reference: Victar Mas (2016)
ISOGG Haplogroup: J1
Comments: downstream FGC2
Forward Primer: ZS10640_F CGTCCTTCACCTGGAGCTG
Reverse Primer: ZS10640_R GGTGACTGCCTTGAAGAAGAC
Reviews

Customers who bought this product also purchased
FGC2
FGC2
FGC4492
FGC4492
FGC29811
FGC29811
FGC5
FGC5
ZS7093
ZS7093
ZS5613
ZS5613
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies